Welcome to the home of The Question Evolution Project. Presenting information demonstrating that there is no truth in minerals-to-man evolution, and presenting evidence for special creation. —Established by Cowboy Bob Sorensen

Friday, June 10, 2016

Evolutionary "Junk" DNA Concepts Foiled Again!

Do evolutionary scientists have ego problems? I've encountered a few that were not above abuse (and even libel) when called out on their faulty reasoning or shown where scientific evidence does not support the falsehoods that they are gleefully teaching. Wouldn't you reckon that, since they've made so many pronouncements that have been shown to be false, they'd learn a bit of humility? Especially when they declare things in the human genome to be "junk" DNA, and are proven wrong. Again.


Evolutionists keep on having to learn the hard way that they should not be making pronouncements on things they haven't thoroughly investigated. "Junk" DNA keeps on being shown to be useful.
Image assembled from components at Clker clipart
DNA is comprised of four bases that are abbreviated A, C, G, and T. When Darwinists examined DNA, they did not understand much of their limited samples, so they declared it to be "junk". Sure, makes perfect sense to examine a little and write it off, right? Not hardly! I reckon that a scientist that did halfhearted work and made assertions would be run out of Dodge for lousy work, especially when "junk" DNA has been shown to be not junk at all, but important. Still, arrogant evolutionary scientists are finding out that things they considered useless or redundant have functions after all. Our Creator had a plan all along, and genetics continues to thwart evolution. Yippie ky yay, secularists!
Repetitious "words" in DNA represent more than half of the human genome's three billion nucleotides.1 Because human reasoning essentially views the repetition of words in spoken languages as errors, these DNA sequences were first written off as meaningless junk. Secular scientists assumed that natural processes somehow produced the repeats over eons of evolution through accidental duplications and that these accidents were carried along in the genome as useless baggage. Now it appears nothing could be further from the truth since these repetitive words are linked with pervasive biochemical function.

One class of repetitious human genome sequences recently highlighted in the news is called tandem repeats (TRs). These are simply stretches of DNA comprised of two or more contiguous copies of a "word" (called a motif) arranged in a head-to-tail pattern. For example, the TR "ttacttacttacttacgttac" is simply a repeat of the four-base motif "ttac" five times. Amazingly, these TRs are found all over the human genome: inside genes, outside genes, and even inside the protein-coding regions of genes. Among individual humans, many TRs vary in the length of the repeat. They have been used in forensics as highly effective DNA markers to solve criminal and paternity cases.
To read the rest, click on "Junk DNA…Trashed Again".


Looking for a comment area?
You can start your own conversation by using the buttons below!

Labels